Piltdown Hoax

The Piltdown Hoax dates back to the discovery of "human" fossils by British paleontologist, Charles Dawson in 1912. Dawson, along with the company of Woodward another archeologist, and French priest Teilhard de Chardin, was able to dig up fossils that were believed to belong to a deceased human being. When first looked at, the fossil appeared to be a deteriorated human jaw bone, most identifiable by its flat, smooth molars. This finding was very significant due to the fact that at the time very little was known of human fossil remains and it ultimately proved that Charles Darwin's theory of evolution was correct. Ultimately in 1953, the news that Piltdown man was a fake rocked the science community worldwide. When tested, it was confirmed that the "Piltdown Man" was a hoax; the jaw and skull had been stained and the teeth had been filed down to appear as a human's. Major criticism was placed upon British scientists for being gullible and not taking the time to properly analyze the Dawson's findings from 1912.

Often human faults come are found within the scientific community although scientists in modern days make an effort to keep them away. As seen through the Piltdown Hoax, scientists do and are capable of making mistakes. The human faults of overlooking and under-analyzing led the British scientists involved with this case to believe that the fossils were indeed human. Sometimes in the rush of excitement and discovery human beings tend to accept things as they are without speculation or second thought. I believe that in this particular hoax/case, that is exactly what happened.

The positive scientific aspects that were responsible for proving that the Piltdown Man was a hoax were a series of experiments and tests. One of these tests was a preliminary fluorine absorption test which ultimately proved that the fossil found by Dawson in 1912 had been stained. Although the reason for the staining remains unknown, it is interesting to notice that no scientist had realized this prior to the discovery of the hoax. Another test ran was the microscopic view of the teeth located on what was believed to be a human mandible. The teeth were in fact proven to had been filed down to create a rather flat look much resembling the structure of human teeth. Multiple scratches from whatever tool that was used to do so were found.

I do believe that it is possible to remove the human factor from science to reduce the chance of future occurrences such as the Piltdown Hoax from happening again. Perhaps a way to do so would be to ensure that scientists thoroughly analyze a fossil or any organism for that matter to ensure that it  is what they perceive it to be. This should always be done, especially before proclaiming things that could change the history and world of science forever. I would not want the human factor to be removed from science because the errors themselves have led scientists to greater discoveries. Science is all about trial and error and learning what is true from what is false, and I believe that without the human fault factor, science would really not be possible.

The lesson that I am able to take from the Piltdown Hoax is that not everything is as it seems. Although it is okay to get caught up in the happiness and excitement that discovery brings along, it is never alright to assume and not question one's findings. Questioning the truth is not always a bad thing and is sometimes necessary to determine what is true and what is false. This thinking ideology     can apply to other things in life outside of science. It is always better to doubt yourself and ensure that you are correct rather than proclaiming things with false evidence.

Homologous & Analogous

Homologous: 

A. A homologous trait that both human beings (homo sapiens) and bats (chiroptera) are located in the forearms of both species. They structurally differ a bit and have different purposes but they share common underlying anatomy and traits.

B. Although the outer appearance of a human forearm and a bat's wing differ greatly, they both contain the same bones: humerus, radius, ulna, carpals, metacarpals, and phalanges. However, the bones of a bat are much smaller and are more delicate. This is due to the fact that the overall forearm/wing of the bat must be lighter in order for the bat to fly in the air with ease. All vertebrate limbs are put together in the same fashion, thus these specific species are homologous for forearm traits. 

C. The common ancestor of this trait would be tetrapods. Tetrapods were the first four-limbed vertebrates and their descendants include the living and extinct amphibians, reptiles, mammals and birds. 

        

Analogous: 

A. The analogous trait that I will be explaining are fins, specifically the fins of a penguin (Spheniscidae) and the fins of a general type of fish. Although these animals differ in size, appearance, and ancestoral origin, they share a similar aspect: their fins and the purpose behind them.

B. Although the outer appearance of a penguin and a normal-sized fish differ greatly, they both obtain fins on the exterior of their body which serve similar purposes. For both a penguin and a fish, their fins are necessary to help navigate themselves in their aquatic habitats. 

C. Since a penguin is a bird and the other creature is a fish, it is underlined that the fin evolved in these extremely different species because it was a necessary functional feature to survive in their environment rather than being inherited from a common ancestor. These two species do not likely have a common ancestor because they come from two completely different classifications. 

   

Blog Post: Protein Synthesis

DNA Molecule:

ATTGTACCAAGATGTAAGTGTTAGCTGAAGTTGGATCCGGC

Test for Comments

This is a test to see if options for commenting are available.

Blog 1: Charles Darwin & Thomas Malthus

1. I believe that Thomas Malthus had the most influence over Darwin’s development of his theory of natural selection. Malthus' work taught Darwin how the process of natural selection ultimately came together. In 1838, Charles Darwin read Malthus' essay titled “An Essay on the Principle of Population”, and was amazed by the theory created by Malthus of making sure resources were available in order to survive and reproduce. Although Malthus had originally tried to provide proof for control of the living, human population, Darwin was generally able to apply his own, unique observations to all living things, not just humans. Thomas Malthus' influence on Charles Darwin was definitely one of a positive manner because Darwin learned how to sustain life and ensure that there would be ongoing generations. 

2. http://www.econlib.org/library/Enc/bios/Malthus.html

Thomas Robert Malthus made a largely significant contribution to the scientific community through his research and evidence made on population. His main contribution was his identification of the relation between resources/food supply and population. Malthus was best known for his theory of limiting the human population rather than growing a greater food supply. In his essay, "An Essay on the Principle of Population", Malthus proved that food supply grows slower than the human population does. 

3. One of the main bullet points most directly affected by Thomas Malthus' work would be the one stating "resources are limited". Malthus believed that since resources were limited, it would be easier to lower the population rate by usage of contraceptives and late marriages, rather than producing labor-intensive crops and food products. Another bullet point, "what is preventing organisms from reproducing at their potential?", would also apply to Malthus. Malthus believed that it would be easier to prevent humans from reproducing than it would be to produce more food supply. 

4. I believe that with Charles Darwin's knowledge and through the use of other scientists' findings and knowledge, Darwin would have been able to develop his theory on natural selection without Thomas Malthus. However, I do believe that it would have taken him longer without the help of Malthus, but I do not doubt that Darwin would have not figured it out on his own. 

5. The attitude of the Church definitely did affect Darwin, most definitely because it prolonged the publication of his book, "On the Origin of Species". During Darwin's day of age, it was seen as very daring and negative to go against the Church's teachings on God's creations, which granted him the title of being unorthodox. The pressure of the Church's teachings ultimately led Darwin to not publish his writings and findings, but with the help of Alfred Wallace, Darwin published his work. Although there were a lot of negative views about Darwin's work from the Church, Darwin still published his theories and gained praise for it over the years. 

Stranded on a Desert Island

If you were stranded on a desert island, what two items would you take with you and why?

     If I were stranded on a desert island, the two items that I would take with me would be a gallon of water and my favorite book, The Great Gatsby. I would take the gallon of water due to the fact that my favorite beverage is water and I consumer over four liters of it each day. The water would keep my hydrated and although it may not prolong my survival, it would definitely keep my cool. I would take The Great Gatsby for the soul purpose of entertainment. This novel is by far my favorite book and I would definitely read it while I was stranded.